Non sporulating endophytic fungi i.e. SH 1 and SH2 were molecular identified based on 18 S rDNA. Extraction of DNA was conducted based on methods of modified Orozco-Castillo et al. (1994). Amplification of fungal DNA using pair of primer ITS1 5’ TCCGTAGGTGAACCTGCGG 3’ dan ITS4 5’ TCCTCCGCTTATTGATATGC 3’ that amplify region internal transcribed spacer (ITS) ribosomal DNA (rDNA) (White et al. 1990). DNA resulted from PCR then sequenced and examined the homology with reference collections of Genebank using BLAST program (www.ncbi.nlm.nih.gov). Species or genus was determined based on percentage of similarity (Arnold and Lutzoni 2007, Crozier et al. 2006).