The adults of S. bispinosa were collected from the paddy field of Kuttanadu of Southern Kerala. The genomic DNA was extracted using GeNei Ultrapure Mammalian Genomic DNA Prep Kit (Bangalore GeNei, Bangalore) as per the Manufacturer’s instruction. The partial gene sequence of COI of S. bispinosa was PCR amplified using the forward primer with DNA sequence 5'CATTGGAGATGACCAAATTTATAATG3' and the reverse primer with DNA sequence 5' TAAACTTCAGGGTGACCAAAAAATCA 3'. The PCR reaction mixture consisted of 2 nanogram of genomic DNA in 1 μl , 1 μl each forward and reverse primers at a concentration of 10 μM, 2.5 μl of dNTPs (2 mM), 2.5 μl 10X reaction buffer, 0.20 μl Taq polymerase (5 U/μl) and 16.8 μl H2O. The PCR temperature profile consisted of 950C/3 minutes as initial denaturation and followed by 45 cycles of 950C/10 seconds, 500C/45 seconds, 720C/45 seconds and with a final extension of 720C for 3 minutes. The PCR amplified product was column purified using Mo Bio UltraClean PCR Clean-up Kit (Mo Bio Laboratories, Inc. California) as per the manufacturer’s instructions. The purified product was sequenced with forward and reverse primers using the Sanger’s sequencing method at SciGenom Labs, Cochin. The forward and reverse sequence was aligned and the consensus sequence was used for analysis. The phylogeny analysis was done using the MEGA5 software