Proliferated shoots (2 cm high) were excised from the mother explants and transferred to rooting medium supplemented with 0.5 mg/l of IAA and 15 mg/l of hygromycin B. Tissue culture-derived tomato plantlets with good developed roots (about 11–14 cm in height) were acclimatized to ex vitro conditions.
2.2. Histochemical GUS assay
Putative transformants were examined for stable GUS expression using 5-bromo-4-chloro-3-indolyl-β-glucuronide (X-Gluc), as described by Jefferson [7].
2.3. PCR analysis
DNA was isolated from GUS positive plants using CTAB method [15]. PCR screening of putative transformants was performed using specific primers for Cry 2Ab gene. The plasmid was used as a positive control. The sequences of forward and reverse primers were 5′CATTCAGCTTCCAGCACAAGAGCC3′; and 5′TGGGTGCCAGAGTTCAGGGTCACG3′, respectively. The PCR mixture were performed in a total volume of 25 μl (1.0 μl of 10 mM dNTPs, 5.0 μl 10× buffer, containing MgCl2, 2.0 μl of 50-ng/μl template DNA, 0.4 μl of Taq polymerase, 1.0 μl of 70 pmol from each primer and 14.6 μl sterile distilled water). Amplification is accomplished through a Thermal Cycler (Biometra, Germany), using first one incubation at 94 °C for 5 min and the step cycle program set to denaturant at 94 °C for 30 s, to anneal at 56 °C for 50 s and then extended at 72 °C for 75 s for a total of 30 cycles; after that, an extra step of extension at 72 °C for 10 min was performed.
2.4. Bioassay
Laboratory cultures of three lepidopterous insect species; S. littoralis, H. armigera and P. operculella were established. Laboratory scale bioassays for the transformed tomato plants were carried out. Plant material to be analyzed was washed with autoclaved distilled water. The toxicity of introduced insecticidal genes was observed by feeding the larvae of target insects on transgenic tomato leaves. Fifteen larvae representing different instars of each insect species were used for each replicate (clone). Three to four pieces of leaves of transgenic plants of different clones were fed to the larvae and the mortality was observed after 1–7 days. The experiments were repeated three times.