The sequences of the five primer pairs for the m-PCR,
their corresponding gene targets and size of expected
amplification products are also shown in Table 2. The
primer sets targeting the highly conserved regions of the
bacterial 16S rRNA gene were
forward primer (F: CAGGCCTAACACATGCAAGTC)
and reverse primer (R: GGCGGWGTGTACAAGGC) that
produced PCR products 1,300 bp in size [23]. 16S rRNA
gene was also targeted as an internal control of the presence
of bacterial DNA.