Standard DNA techniques and manipulations of Escherichia coli
and S. cerevisiae strains have been described elsewhere (Guthrie
and Fink 1991; Maniatis et al. 1989). An RsaI fragment containing
the MDH2-coding sequence from plasmid BS())BRRMDH2,
kindly provided by L. McAlister-Henn, was cloned into the EcoRV
site of Bluescript. The resulting plasmid (Bluescript-MDH2) was
used to clone MDH2 into the SalI and BamHI sites of YEp51 and
the SalI and SacI sites of pRS-426-PGK. Mutagenesis using
polymerase chain reaction (PCR) technology was employed to in-
troduce an XhoI site at a position corresponding to the 12th amino
acid of MDH2. The sequence of the oligodeoxyribonucleotide used
as a primer to introduce an XhoI site was CCGCTCGA-
GATGTTAAAAATTGCCATTTTAGGT together with the T3
primer and Bluescript-MDH2 as the template. The shorter version
of the MDH2 gene was cloned ®rst into the XhoI and BamHI sites
of Bluescript and, after its sequence had been veri®ed, it was cloned
into the SalI and BamHI sites of YEp51.