Preliminary identification of strain B04
Strain B04 was cultured on a glucose yeast malt extract medium
plate containing the following (g l1): yeast extract 3.0, malt
extract 3.0, peptone 5.0, glucose 10.0, agar 20 (pH 7.2). The air-
mycelium and conidiospore morphology was observed with a light
microscope and a scanning electron microscope. For 16S rRNA gene
sequence analysis of strain B04, DNA was isolated using the
procedure described in the UltraClean1 Microbial DNA Isolation
Kit and then subjected to PCR amplification using primers 27f
(AGAGTTTGATCCTGGCTCAG) and 1492r (TACGGYTACCTTGTTAC-
GACTT), as described by Eden et al. (1991). The 16S rRNA gene
sequence was analyzed using BLASTN and the NCBI GenBank
database, and the sequences of the Streptomyces strains with high
similarities were used to construct the phylogenetic tree by the
maximum likelihood method using Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0