For quantitative analysis of VEGF mRNA alternative
splice form, real-time PCR was performed on Roter Gene 2000
real-time amplification operator (Cor bett Research, Mortlake, Australia). Primers were
made based on previous report [23] as follows: VEGF
forward, CCCTGATGAGATCGAGTACATCTT ( this primer was used for detecting both 121 and 165 spe cies); VEGF-165 reverse, AGCAAGGCCCACAGGGATTT; VEGF-121 reverse GCCTCGGCTTGTCACATTTT.