The cDNA of the cis-acting CChMVd-HHR was PCR-amplified with
Taq DNA polymerase as described in Ztouti et al. [23] using 5′-GTCG
GCACCTGACGTCGGTGTCCTGATGAAGATCCATGAGAGGATCGAAACCTCT
TCTAG-3′ as template, and 5′-TAATACGACTCACTATAGGAAGAGGTCGG
CACCTGACGTCGG-3′ containing the T7 RNA polymerase promoter
(underlined), as sense primer and 5′-CTAGAAGAGGTTTCGATCCTCTC-
3′ as antisense primer. The CChMVd-HHR was synthesized by overnight
in vitro transcription of the PCR products. To avoid cleavage during transcription, a deoxyribonucleotide (5′-CATGGATCTTCATCAGGACACC
GAC-3′), complementary to a part of the HHR [15] was used in the transcription mixture at a concentration of 10 μM. The RNAs obtained were
purified by denaturing (7 M urea) 15% polyacrylamide gel electrophoresis (PAGE) and eluted from the gel overnight in 300 mM sodium
acetate, pH 5.2 at 4 °C. The RNAs were recovered from the solution by
filtration through 0.22 μm diameter micro-filters and precipitation
with ethanol. The purified ribozyme was finally resuspended in water
and stored at − 20 °C.