Universal primers identifying LAB, designed using the invariant region in the 16 s rDNA sequences for LAB (Wang et al., 1996), were obtained from Sigma Scientific Services Co., Germany. The reaction mixture (20 µl) consisted of 5 µl colourless GoTaq reaction Buffer (5x), 0.25 µl GoTaq DNA Polymerase (5 u/µl) (Promega, USA), 2.5 µl PCR nucleotide Mix (10 mM), 1 µl of each primer 5/CGTGCCAGCCGCGGTAATACG 3/and 5/GGGTTGCGCTCGTTGCGGGACT TAACCCAACAT 3/) as forward and reverse primers, respectively, 2 µl genomic DNA and 8.25 µl of nuclease-free water.