Primers were made based on previous report [23] as follows: VEGF forward, CCCTGATGAGATCGAGTACATCTT ( this primer was used for detecting both 121 and 165 spe cies); VEGF-165 reverse, AGCAAGGCCCACAGGGATTT; VEGF-121 reverse GCCTCGGCTTGTCACATTTT.
Primers weremade based on previous report [23] as follows: VEGFforward, CCCTGATGAGATCGAGTACATCTT ( this primer was used for detecting both 121 and 165 spe cies); VEGF-165 reverse, AGCAAGGCCCACAGGGATTT; VEGF-121 reverse GCCTCGGCTTGTCACATTTT.