2. Materials and methods
2.1. Fungal isolation and identification
P. expansum was initially isolated from the naturally infected pear fruits (Pyrus bretschneideri Rehd.) as described by Qinet al. (2007) and maintained on potato dextrose agar (PDA)plates. Total DNA of pathogen was isolated using a DNeasy Plant Mini kit (Qiagen, Germany), following the manufacturer’s instructions. The complete rDNA-ITS of the isolated was amplified using universal primers ITS4 (TCCTCCGCTTATTGATATGC) and ITS5 (GGAAGGTAAAAGTCGTAACAAG) by routine PCR approach. The sequencing results of amplified products were analyzed in 100 mL PDB medium with 0 or 0.6% NaHCO3 to obtain a final concentration of 1.0 × 106spores/mL. After incubation of 12, 24, 36 and48 h, the dry weight of hypha was measured after repeated wash-ing of mycelial pellets with distilled water and during at 70◦C inhot-air oven to a constant weight. Each treatment was replicated
three times and the experiment was repeated.