A final elongation step was carried
out at 72
C for 5 min. To rule out the presence of Agrobacterium
contamination in transgenic shoots generated after transformation,
PCR amplification was carried out with Kan-gene specific
primers, lying outside the T-DNA borders, present in the backbone
of binary vector (Figs. 2 and 4). Primers used for PCR
◦
amplification were KanF-5
KanR-5
AGGCTCTTTCACTCCATCG3
GCAGAAGGCAATGTCATACC3
). PCR products were separated
using agarose gel electrophoresis and visualized under UV light.
Transformation frequency was calculated by dividing the number
of PCR positive transformants by the total number of callus pieces