PCR analysis
DNA was isolated from GUS positive plants using CTAB method [15]. PCR screening of putative transformants was performed using specific primers for Cry 2Ab gene. The plasmid was used as a positive control. The sequences of forward and reverse primers were 5′CATTCAGCTTCCAGCACAAGAGCC3′; and 5′TGGGTGCCAGAGTTCAGGGTCACG3′, respectively. The PCR mixture were performed in a total volume of 25 μl (1.0 μl of 10 mM dNTPs, 5.0 μl 10× buffer, containing MgCl2, 2.0 μl of 50-ng/μl template DNA, 0.4 μl of Taq polymerase, 1.0 μl of 70 pmol from each primer and 14.6 μl sterile distilled water). Amplification is accomplished through a Thermal Cycler (Biometra, Germany), using first one incubation at 94 °C for 5 min and the step cycle program set to denaturant at 94 °C for 30 s, to anneal at 56 °C for 50 s and then extended at 72 °C for 75 s for a total of 30 cycles; after that, an extra step of extension at 72 °C for 10 min was performed