From the design primer in each software, I choose primer design from three software. First pair http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi 5’TTAGGCTTCATGTCCCTGCT 3’ and 5’CCCCTGGTTGTGAAATCAAT 3’, second software http://biotools.umassmed.edu/bioapps/primer3_www.cgi 5’TTAGGCTTCATGTCCCTGCT 3’ and 5’CCCCTGGTTGTGAAATCAAT 3’, and third http://www.ncbi.nlm.nih.gov/tools/primer-blast/ 5’GAAGTCGTGTGGCAACAACC 3’ and 5’ACGAGCTGTCCAACACTGAG 3’,Because there are have closely Primer Melting Temperature (Tm) value that is the temperature at which one half of the DNA duplex will dissociate to become single stranded. Tm of the primer should between 52-60 oC. GC content, The GC content of primer should be
40-60%.and GC content give indicate for Tm value. And there are low self complementary.