Isolate I-41.3s was grown on PDA in a 9 cm Petri plate
for 21 days at 25 8C. Liquid cultures of the fungus were set
up in Potato Dextrose Broth at room temperature for 14
days. The cultures were passed through a filter by applying
vacuum and the mycelium that was collected was scraped
from the filter, weighed and placed in liquid nitrogen.
Nucleic acid (DNA) was extracted using the EZNA fungi
genomic DNA kit (D3490-01) according to the manufacturer’s
directions. The 5.8S rDNA sequence was amplified
by polymerase chain reaction using the primers ITS1
(TCCGTAGGTGAACCTGCGGG) and ITS4 (TCCTCCGCTTATTGATATGC).
The amplified fragment was visualized
using agarose gel electrophoresis and cloned into the
cloning vector pGEMT-EASY (Promega). The obtained
plasmid was finally sequenced by the Plant–Microbe
Genomic Facility at Ohio State University using an applied
3700 DNA analyzer [5], and the obtained sequence was
checked against sequences available in GenBank using
BLAST.