2.2. Details of vector construction
2.2.1. Primer design and gfp fragments amplified
Primers were designed according to thegfpgene search from
NCBI and the multiple cloning site of PBC-hygro using Soft-ware Primer 5.0. Restriction enzyme sites were added to primer
GFPup1 and Down1. Thegfpgene was amplified from pEG-FP by PCR using the primer GFPup1: GGGAAGCTTAG
TGCTGAAACCTCCGTAT (contain HindIII enzyme site)
and GFPdown1: GGCGAATTCCACCTTGATGCCG (con-taining ECOlI enzyme site).