2.6. DNA extraction and sequencing

2.6. DNA extraction and sequencing To extract DNA from pure cultures of isolated fungi, 10 mL of PD broth (Difco, NJ) was inoculated with conidia taken from discrete colonies and grown at 20 C for 2 days. The medium was then filtered through sterile Whatman’s No. 1 filter paper. DNA was isolated from mycelia after grinding in liquid nitrogen, using Puregene DNA isolation solutions (Qiagen) following the manufacturer’s instructions and re-suspending in 20 ll of sterile ddH2O. The concentration of DNA used in the PCR reactions was determined empirically and ranged from 1 to a 10 dilution of the initial isolation. Amplification of a fragment of the EF1-a gene was performed using the primers EF349 (50 - TGGCCACCAGCACTCACTAC) and EF1685R (50 - ATGTCACGGACGGCGAAA), designed to amply an internal fragment of approximately 1350 bp. PCR reactions were performed in 25 ll volumes containing 0.4 lM of each primer (Invitrogen, California), 200 lM dNTPs (Innovative Sciences, Dunedin, New Zealand), 2.5 ll reaction buffer, 1.5 mM MgCl2, 2 ll DNA and FastStart Taq (0.7 U/reaction) (Roche). Amplifications were carried out in a thermal cycler (Mastercycler) using 40 cycles of 45 s at 95 C, 45 s at 55 C and 2 min at 72 C. Positive and negative (dH2O) controls were included in each PCR run. PCR products were sequenced directly (Lincoln University Sequencing Unit, New Zealand). Sequences were checked for identification first by BLASTN (Altschul et al., 1990), then Beauveria sequences aligned with previously obtained sequences for the isolates F647 and F668 using DNAMan (Lynnon Biosoft, Canada) and MEGA (Kumar et al., 2008