Identification of the selected fungus by ITS-DNA sequence
The selected fungus strain was identified based on both microscopic
morphology and analysis of the nucleotide sequence of the
ITS1-5.8-ITS2 ribosomal RNA region. The genomic DNA was
extracted from the fungal cells using the methods of phenolcloroform.
The primers ITS1 (50-30) TCCGTAGGTGAACCTGCGG and
ITS4 (50-30) TCCTCCGCTTATTGATATGC were used to amplify the
region (630 pb) from total cellular DNA. Amplification began with a
DNA denaturation step for 5 min at 94 C; the following cycles
included 45 s denaturation at 94 C, 45 s annealing at 50 C and
1 min extension at 72 C and were repeated 30 times. Primer
extension at 72 C for 5 min completed the final cycle. PCR products
were analyzed and further purified by electrophoresis on 1.2%
agarose gels.
The final sequence of the purified ampliconwas compared to the
international database Genbank/EMBL/DDBJ with the BLAST homology
search program at http://www.ncbi.nlm.nih.gov/BLAST/
(Zhang et al., 2000). Homologous sequences of appropriate quality
were downloaded for further cladistic analysis. Experimental
and downloaded sequences were aligned with clustral X
(Thompson and Gibson, 1997). The sequences were further visually
aligned with a text editor. The phylogenetic tree was constructed
with Clustral X software using the neighbor-joining method.